11-5226796-CAGCCTAAGGGTGGGAAAATAGACCA-CAGCCTAAGGGTGGGAAAATAGACCAAGCCTAAGGGTGGGAAAATAGACCA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000518.5(HBB):​c.93-22_95dupTGGTCTATTTTCCCACCCTTAGGCT​(p.Leu33GlyfsTer7) variant causes a frameshift, stop gained, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. L32L) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

HBB
NM_000518.5 frameshift, stop_gained, splice_region

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 2.95

Publications

7 publications found
Variant links:
Genes affected
HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
HBB Gene-Disease associations (from GenCC):
  • dominant beta-thalassemia
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
  • hemoglobin M disease
    Inheritance: AD Classification: DEFINITIVE, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen
  • beta thalassemia
    Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
  • beta-thalassemia HBB/LCRB
    Inheritance: AR, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
  • sickle cell disease and related diseases
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • erythrocytosis, familial, 6
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Heinz body anemia
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • sickle cell disease
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
  • hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • beta-thalassemia intermedia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • beta-thalassemia major
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • delta-beta-thalassemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hemoglobin C disease
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hemoglobin C-beta-thalassemia syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hemoglobin E disease
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hemoglobin E-beta-thalassemia syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hereditary persistence of fetal hemoglobin-sickle cell disease syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • sickle cell-beta-thalassemia disease syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • sickle cell-hemoglobin c disease syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • sickle cell-hemoglobin d disease syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • sickle cell-hemoglobin E disease syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 240 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
HBBNM_000518.5 linkc.93-22_95dupTGGTCTATTTTCCCACCCTTAGGCT p.Leu33GlyfsTer7 frameshift_variant, stop_gained, splice_region_variant Exon 2 of 3 ENST00000335295.4 NP_000509.1 P68871D9YZU5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
HBBENST00000335295.4 linkc.93-22_95dupTGGTCTATTTTCCCACCCTTAGGCT p.Leu33GlyfsTer7 frameshift_variant, stop_gained, splice_region_variant Exon 2 of 3 1 NM_000518.5 ENSP00000333994.3 P68871

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs193922563; hg19: chr11-5248026; API