11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-CGCCGCCGCAGCAGCAGCAGCAGCAGCCGCCGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_StrongBS2
The NM_018026.4(PACS1):c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC(p.Gln37_Gln44dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00025 in 151,776 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_018026.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PACS1 | NM_018026.4 | c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC | p.Gln37_Gln44dup | disruptive_inframe_insertion | Exon 1 of 24 | ENST00000320580.9 | NP_060496.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PACS1 | ENST00000320580.9 | c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC | p.Gln37_Gln44dup | disruptive_inframe_insertion | Exon 1 of 24 | 1 | NM_018026.4 | ENSP00000316454.4 | ||
PACS1 | ENST00000527224.1 | n.234_257dupAGCAGCAGCAGCCGCCGCAGCAGC | non_coding_transcript_exon_variant | Exon 1 of 7 | 2 |
Frequencies
GnomAD3 genomes AF: 0.000251 AC: 38AN: 151668Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.000232 AC: 22AN: 94962Hom.: 0 AF XY: 0.000333 AC XY: 18AN XY: 54004
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000602 AC: 808AN: 1341878Hom.: 0 Cov.: 31 AF XY: 0.000583 AC XY: 386AN XY: 662332
GnomAD4 genome AF: 0.000250 AC: 38AN: 151776Hom.: 0 Cov.: 32 AF XY: 0.000216 AC XY: 16AN XY: 74180
ClinVar
Submissions by phenotype
not specified Benign:1
- -
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
PACS1-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
not provided Benign:1
- -
Schuurs-Hoeijmakers syndrome Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at