12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCA
• rs3832799
• NM_004316.4:c.163_186dupCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_004316.4(ASCL1):​c.163_186dupCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln55_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00032 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000083 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ASCL1 NM_004316.4 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.219
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASCL1	NM_004316.4	c.163_186dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln55_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	ENST00000266744.4	NP_004307.2
PAH	NM_001354304.2	c.-318_-295dupTGCTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR_variant	Exon 1 of 14		NP_001341233.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASCL1	ENST00000266744.4	c.163_186dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln55_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	1	NM_004316.4	ENSP00000266744.3
PAH	ENST00000547319.1	n.-7_17dupTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 1 of 3	4
PAH	ENST00000551337.5	c.-318_-295dupTGCTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3		ENSP00000447620.1
PAH	ENST00000635500.1	n.-195_-172dupTGCTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.000320 AC: 48 AN: 150118 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00105

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000198

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.000487

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000825 AC: 112 AN: 1356926 Hom.: 0 Cov.: 17 AF XY: 0.0000687 AC XY: 46 AN XY: 669228

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00137 AC: 39 AN: 28500

American (AMR) AF: 0.000119 AC: 4 AN: 33690

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24016

East Asian (EAS) AF: 0.000120 AC: 4 AN: 33382

South Asian (SAS) AF: 0.00 AC: 0 AN: 75998

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41214

Middle Eastern (MID) AF: 0.000245 AC: 1 AN: 4084

European-Non Finnish (NFE) AF: 0.0000538 AC: 57 AN: 1059576

Other (OTH) AF: 0.000124 AC: 7 AN: 56466

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000320 AC: 48 AN: 150208 Hom.: 0 Cov.: 0 AF XY: 0.000245 AC XY: 18 AN XY: 73324

African (AFR) AF: 0.00105 AC: 43 AN: 40992

American (AMR) AF: 0.000198 AC: 3 AN: 15154

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5054

South Asian (SAS) AF: 0.00 AC: 0 AN: 4762

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67372

Other (OTH) AF: 0.000483 AC: 1 AN: 2072

Alfa AF: 0.00 Hom.: 277

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.22
Mutation Taster		=79/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;