12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs3832799
• NM_004316.4:c.186_187insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_004316.4(ASCL1):​c.186_187insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln62_Ala63insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000013 (0 hom., cov: 0)
• Consequence: ASCL1 NM_004316.4 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.219
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004316.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASCL1	NM_004316.4	MANE Select	c.186_187insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln62_Ala63insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	conservative_inframe_insertion	Exon 1 of 2	NP_004307.2
	PAH	NM_001354304.2		c.-295_-294insTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR	Exon 1 of 14	NP_001341233.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASCL1	ENST00000266744.4	TSL:1 MANE Select	c.186_187insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln62_Ala63insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	conservative_inframe_insertion	Exon 1 of 2	ENSP00000266744.3
	PAH	ENST00000547319.1	TSL:4	n.17_18insTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon	Exon 1 of 3
	PAH	ENST00000551337.5	TSL:3	c.-295_-294insTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		upstream_gene	N/A	ENSP00000447620.1

Frequencies

GnomAD3 genomes AF: 0.0000133 AC: 2 AN: 150120 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000489

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 17

GnomAD4 genome AF: 0.0000133 AC: 2 AN: 150120 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73222

African (AFR) AF: 0.0000489 AC: 2 AN: 40886

American (AMR) AF: 0.00 AC: 0 AN: 15138

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5070

South Asian (SAS) AF: 0.00 AC: 0 AN: 4768

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67382

Other (OTH) AF: 0.00 AC: 0 AN: 2052

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.22
Mutation Taster		=79/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;