12-49033482-TTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_003482.4(KMT2D):c.11202_11222dupGCAGCAGCAGCAGCAGCAGCA(p.Gln3741_Gln3742insGlnGlnGlnGlnGlnGlnGln) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_003482.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndromeInheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Illumina, G2P
- Kabuki syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Laboratory for Molecular Medicine, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
- branchial arch abnormalities, choanal atresia, athelia, hearing loss, and hypothyroidism syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Kabuki syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003482.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | NM_003482.4 | MANE Select | c.11202_11222dupGCAGCAGCAGCAGCAGCAGCA | p.Gln3741_Gln3742insGlnGlnGlnGlnGlnGlnGln | disruptive_inframe_insertion | Exon 40 of 55 | NP_003473.3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | ENST00000301067.12 | TSL:5 MANE Select | c.11202_11222dupGCAGCAGCAGCAGCAGCAGCA | p.Gln3741_Gln3742insGlnGlnGlnGlnGlnGlnGln | disruptive_inframe_insertion | Exon 40 of 55 | ENSP00000301067.7 | ||
| KMT2D | ENST00000683543.2 | c.11202_11222dupGCAGCAGCAGCAGCAGCAGCA | p.Gln3741_Gln3742insGlnGlnGlnGlnGlnGlnGln | disruptive_inframe_insertion | Exon 40 of 56 | ENSP00000506726.1 | |||
| KMT2D | ENST00000685166.1 | c.11211_11231dupGCAGCAGCAGCAGCAGCAGCA | p.Gln3744_Gln3745insGlnGlnGlnGlnGlnGlnGln | disruptive_inframe_insertion | Exon 39 of 54 | ENSP00000509386.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 47
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Kabuki syndrome Uncertain:1
This variant, c.11202_11222dup, results in the insertion of 7 amino acid(s) of the KMT2D protein (p.Gln3739_Gln3745dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KMT2D-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at