12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs60216939
• NM_001940.4:c.1467_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001940.4(ATN1):​c.1467_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln489_Gln502dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. H503H) has been classified as Uncertain significance.

• Frequency:
  • Genomes: 𝑓 0.000021 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000023 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATN1 NM_001940.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.621
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Illumina, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATN1	NM_001940.4	c.1467_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln489_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	ENST00000396684.3	NP_001931.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATN1	ENST00000396684.3	c.1467_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln489_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	1	NM_001940.4	ENSP00000379915.2
ATN1	ENST00000356654.8	c.1467_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln489_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	1		ENSP00000349076.3

Frequencies

GnomAD3 genomes AF: 0.0000207 AC: 3 AN: 145034 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000422

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000150

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000229 AC: 33 AN: 1438908 Hom.: 0 Cov.: 0 AF XY: 0.0000237 AC XY: 17 AN XY: 716726

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32226

American (AMR) AF: 0.00 AC: 0 AN: 40114

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25686

East Asian (EAS) AF: 0.000464 AC: 18 AN: 38776

South Asian (SAS) AF: 0.0000935 AC: 8 AN: 85556

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52578

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5722

European-Non Finnish (NFE) AF: 0.00000637 AC: 7 AN: 1098784

Other (OTH) AF: 0.00 AC: 0 AN: 59466

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000207 AC: 3 AN: 145034 Hom.: 0 Cov.: 0 AF XY: 0.0000284 AC XY: 2 AN XY: 70354

African (AFR) AF: 0.00 AC: 0 AN: 38648

American (AMR) AF: 0.00 AC: 0 AN: 13890

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.000422 AC: 2 AN: 4734

South Asian (SAS) AF: 0.00 AC: 0 AN: 4434

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10080

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 310

European-Non Finnish (NFE) AF: 0.0000150 AC: 1 AN: 66710

Other (OTH) AF: 0.00 AC: 0 AN: 1964

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.62
Mutation Taster		=87/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;