12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001940.4(ATN1):c.1464_1508dup(p.Gln488_Gln502dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q487Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000034 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000019 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATN1 NM_001940.4 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.621

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ATN1	NM_001940.4	c.1464_1508dup	p.Gln488_Gln502dup	inframe_insertion	5/10	ENST00000396684.3
ATN1	NM_001007026.2	c.1464_1508dup	p.Gln488_Gln502dup	inframe_insertion	5/10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ATN1	ENST00000396684.3	c.1464_1508dup	p.Gln488_Gln502dup	inframe_insertion	5/10	1	NM_001940.4	P1
ATN1	ENST00000356654.8	c.1464_1508dup	p.Gln488_Gln502dup	inframe_insertion	5/10	1		P1

Frequencies

GnomAD3 genomes AF: 0.0000345 AC: 5 AN: 145034 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000259

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000634

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000509

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000195 AC: 28 AN: 1438890 Hom.: 0 Cov.: 0 AF XY: 0.0000223 AC XY: 16 AN XY: 716720

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000516

Gnomad4 SAS exome AF: 0.0000234

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000364

Gnomad4 OTH exome AF: 0.0000336

GnomAD4 genome AF: 0.0000345 AC: 5 AN: 145034 Hom.: 0 Cov.: 0 AF XY: 0.0000142 AC XY: 1 AN XY: 70354

Gnomad4 AFR AF: 0.0000259

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000634

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000509

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;