13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr13-70139383-A-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCAGCTG
• rs193922930
• ENST00000673087.1:n.48_49insCAGCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000673087.1(ENSG00000288330):​n.48_49insCAGCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000034 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ENSG00000288330 ENST00000673087.1 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36
• Publications: 0 publications found

Genes affected

ENSG00000288330 (HGNC:32925):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ATXN8OS Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 8

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN8OS	NR_002717.3	n.940_941insTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 5 of 5
ATXN8OS	NR_185834.1	n.454-7926_454-7925insTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 3 of 4
ATXN8OS	NR_185835.1	n.454-7926_454-7925insTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 3 of 6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ENSG00000288330	ENST00000673087.1	n.48_49insCAGCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	Exon 1 of 1
ATXN8OS	ENST00000756272.1	n.813_814insTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 5 of 5
ATXN8OS	ENST00000660386.1	n.451-7926_451-7925insTGCTGCTGCAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 3 of 3

Frequencies

GnomAD3 genomes AF: 0.000202 AC: 22 AN: 109108 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000905

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000344 AC: 12 AN: 349204 Hom.: 0 Cov.: 0 AF XY: 0.0000215 AC XY: 4 AN XY: 186202

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00127 AC: 10 AN: 7904

American (AMR) AF: 0.00 AC: 0 AN: 18694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 11978

East Asian (EAS) AF: 0.00 AC: 0 AN: 24794

South Asian (SAS) AF: 0.00 AC: 0 AN: 26972

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 21224

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1578

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 216160

Other (OTH) AF: 0.000101 AC: 2 AN: 19900

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000276), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000202 AC: 22 AN: 109138 Hom.: 0 Cov.: 0 AF XY: 0.000209 AC XY: 11 AN XY: 52664

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000903 AC: 22 AN: 24356

American (AMR) AF: 0.00 AC: 0 AN: 10972

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2848

East Asian (EAS) AF: 0.00 AC: 0 AN: 3730

South Asian (SAS) AF: 0.00 AC: 0 AN: 3612

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6518

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 236

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 54680

Other (OTH) AF: 0.00 AC: 0 AN: 1416

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;