13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NR_002717.2(ATXN8OS):​n.1110_1148dup variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000064 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000052 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN8OS NR_002717.2 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36

Genes affected

(HGNC:):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 7 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN8OS	NR_002717.2	n.1110_1148dup		non_coding_transcript_exon_variant	5/5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
	ENST00000673087.1	n.48_49insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	1/1
ATXN8OS	ENST00000678624.1	n.500-7964_500-7926dup		intron_variant, non_coding_transcript_variant

Frequencies

GnomAD3 genomes AF: 0.0000642 AC: 7 AN: 109116 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000411

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000351

Gnomad EAS AF: 0.000534

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000153

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000366

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000515 AC: 18 AN: 349204 Hom.: 0 Cov.: 0 AF XY: 0.0000430 AC XY: 8 AN XY: 186202

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.000160

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000807

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000471

Gnomad4 NFE exome AF: 0.0000463

Gnomad4 OTH exome AF: 0.000101

GnomAD4 genome AF: 0.0000642 AC: 7 AN: 109116 Hom.: 0 Cov.: 0 AF XY: 0.0000190 AC XY: 1 AN XY: 52594

Gnomad4 AFR AF: 0.0000411

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.000351

Gnomad4 EAS AF: 0.000534

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000153

Gnomad4 NFE AF: 0.0000366

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;