15-25339141-AGCATGCCAAATCCTTTGGCATACGTGATGGCCTTCAACAATCTCTCTTTAAGTTTTTCTTTGCTTGAG-A
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_ModeratePM2PP5
The NM_130839.5(UBE3A):c.2547_2614delCTCAAGCAAAGAAAAACTTAAAGAGAGATTGTTGAAGGCCATCACGTATGCCAAAGGATTTGGCATGC(p.Ser850fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Genomes: not found (cov: 32)
Consequence
UBE3A
NM_130839.5 frameshift
NM_130839.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.32
Genes affected
UBE3A (HGNC:12496): (ubiquitin protein ligase E3A) This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
SNHG14 (HGNC:37462): (small nucleolar RNA host gene 14) This gene is located within the Prader-Willi critical region and produces a long, spliced paternally-imprinted RNA that initiates within a common upstream promoter region shared by the SNRPN (small nuclear ribonucleoprotein polypeptide N) and SNURF genes. This transcript serves as a host RNA for the small nucleolar RNA, C/D box 115 and 116 clusters. This RNA extends in antisense into the region of the ubiquitin protein ligase E3A gene (UBE3A), and is thought to regulate imprinted expression of UBE3A in the brain. This transcript undergoes extensive alternative splicing, and may initiate and terminate at multiple locations within this genomic region. The full-length structure of all splice forms is not determined. [provided by RefSeq, Mar 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 5 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0275 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 15-25339141-AGCATGCCAAATCCTTTGGCATACGTGATGGCCTTCAACAATCTCTCTTTAAGTTTTTCTTTGCTTGAG-A is Pathogenic according to our data. Variant chr15-25339141-AGCATGCCAAATCCTTTGGCATACGTGATGGCCTTCAACAATCTCTCTTTAAGTTTTTCTTTGCTTGAG-A is described in ClinVar as [Pathogenic]. Clinvar id is 155980.Status of the report is no_assertion_criteria_provided, 0 stars.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link
Submissions by phenotype
Angelman syndrome Pathogenic:1
Pathogenic, no assertion criteria provided | clinical testing | Baylor Genetics | Feb 14, 2014 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at