15-76995149-GCTGCCTGCCTGC-GCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTGC

Variant names:

• chr15-76995149-G-GCTGCCTGCCTGCCTGCCTGC
• rs55909412
• ENST00000558012:c.-421_-402dupCCTGCCTGCCTGCCTGCCTG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_003978.5(PSTPIP1):​c.-421_-402dupCCTGCCTGCCTGCCTGCCTG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000659 in 151,814 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000066 (0 hom., cov: 28)
  • Exomes 𝑓: 0.00012 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PSTPIP1 NM_003978.5 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.64

Genes affected

PSTPIP1 (HGNC:9580): (proline-serine-threonine phosphatase interacting protein 1) This gene encodes a cytoskeletal protein that is highly expressed in hemopoietic tissues. This protein functions via its interaction with several different proteins involved in cytoskeletal organization and inflammatory processes. It binds to the cytoplasmic tail of CD2, an effector of T cell activation and adhesion, downregulating CD2-triggered adhesion. It binds PEST-type protein tyrosine phosphatases (PTP) and directs them to c-Abl kinase to mediate c-Abl dephosphorylation, thereby, regulating c-Abl activity. It also interacts with pyrin, which is found in association with the cytoskeleton in myeloid/monocytic cells and modulates immunoregulatory functions. Mutations in this gene are associated with PAPA (pyogenic sterile arthritis, pyoderma gangrenosum, and acne) syndrome. It is hypothesized that the disease-causing mutations compromise physiologic signaling necessary for the maintenance of a proper inflammatory response. [provided by RefSeq, Mar 2016]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 10 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PSTPIP1	NM_003978.5	c.-421_-402dupCCTGCCTGCCTGCCTGCCTG		5_prime_UTR_variant	Exon 1 of 15	ENST00000558012.6	NP_003969.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PSTPIP1	ENST00000558012	c.-421_-402dupCCTGCCTGCCTGCCTGCCTG		5_prime_UTR_variant	Exon 1 of 15	1	NM_003978.5	ENSP00000452746.1

Frequencies

GnomAD3 genomes AF: 0.0000527 AC: 8 AN: 151702 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000195

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000884

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000120 AC: 122 AN: 1018844 Hom.: 0 Cov.: 30 AF XY: 0.000121 AC XY: 59 AN XY: 486186

Gnomad4 AFR exome AF: 0.0000475

Gnomad4 AMR exome AF: 0.000103

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000335

Gnomad4 SAS exome AF: 0.0000559

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000127

Gnomad4 OTH exome AF: 0.0000825

GnomAD4 genome AF: 0.0000659 AC: 10 AN: 151814 Hom.: 0 Cov.: 28 AF XY: 0.0000809 AC XY: 6 AN XY: 74178

Gnomad4 AFR AF: 0.0000723

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000195

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000884

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55909412; hg19: chr15-77287490;