15-89776930-GCAGGGGCAAGGACAGGGGCAAGGA-G
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001039958.2(MESP2):c.585_608delACAGGGGCAAGGACAGGGGCAAGG(p.Gln196_Gly203del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. G195G) has been classified as Uncertain significance.
Frequency
Consequence
NM_001039958.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- spondylocostal dysostosis 2, autosomal recessiveInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- autosomal recessive spondylocostal dysostosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001039958.2. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MESP2 | TSL:1 MANE Select | c.585_608delACAGGGGCAAGGACAGGGGCAAGG | p.Gln196_Gly203del | disruptive_inframe_deletion | Exon 1 of 2 | ENSP00000342392.3 | Q0VG99 | ||
| MESP2 | TSL:1 | c.31-1123_31-1100delACAGGGGCAAGGACAGGGGCAAGG | intron | N/A | ENSP00000452998.1 | H0YKZ5 | |||
| MESP2 | TSL:3 | n.39-1123_39-1100delACAGGGGCAAGGACAGGGGCAAGG | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000696 AC: 1AN: 143700Hom.: 0 AF XY: 0.0000140 AC XY: 1AN XY: 71594 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at