16-16182884-GACCGACAACAGCCAGCAGACAGC-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001171.6(ABCC6):c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT(p.Gly656AlafsTer77) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001171.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- arterial calcification, generalized, of infancy, 2Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
- autosomal recessive inherited pseudoxanthoma elasticumInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae), G2P
- arterial calcification of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ABCC6 | NM_001171.6 | c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT | p.Gly656AlafsTer77 | frameshift_variant | Exon 16 of 31 | ENST00000205557.12 | NP_001162.5 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ABCC6 | ENST00000205557.12 | c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT | p.Gly656AlafsTer77 | frameshift_variant | Exon 16 of 31 | 1 | NM_001171.6 | ENSP00000205557.7 | ||
| ABCC6 | ENST00000456970.6 | n.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT | non_coding_transcript_exon_variant | Exon 16 of 29 | 2 | ENSP00000405002.2 | ||||
| ABCC6 | ENST00000622290.5 | n.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT | non_coding_transcript_exon_variant | Exon 16 of 32 | 5 | ENSP00000483331.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive inherited pseudoxanthoma elasticum Pathogenic:2
- -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at