16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
• rs71156237
• ENST00000301008.5:n.691_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The ENST00000301008.5(JPH3):​n.691_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00065 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000037 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: JPH3 ENST00000301008.5 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.966
• Publications: 1 publications found

Genes affected

JPH3 (HGNC:14203): (junctophilin 3) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]

JPH3 Gene-Disease associations (from GenCC):

• Huntington disease-like 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 97 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
JPH3	NM_020655.4	c.382+760_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	ENST00000284262.3	NP_065706.2
JPH3	NM_001271604.4	c.431_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	p.Ala157_Val158insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 2 of 2		NP_001258533.1
JPH3	NM_001271605.3	c.*129_*170dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	Exon 2 of 2		NP_001258534.1
JPH3	NR_073379.3	n.96+2358_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
JPH3	ENST00000301008.5	n.691_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		non_coding_transcript_exon_variant	Exon 2 of 2	1
JPH3	ENST00000284262.3	c.382+760_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	1	NM_020655.4	ENSP00000284262.2
JPH3	ENST00000537256.5	n.96+2358_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5	2

Frequencies

GnomAD3 genomes AF: 0.000647 AC: 97 AN: 149958 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00234

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000661

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000487

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000366 AC: 47 AN: 1282844 Hom.: 0 Cov.: 30 AF XY: 0.0000395 AC XY: 25 AN XY: 633004

African (AFR) AF: 0.00102 AC: 29 AN: 28326

American (AMR) AF: 0.000185 AC: 6 AN: 32398

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21658

East Asian (EAS) AF: 0.00 AC: 0 AN: 24078

South Asian (SAS) AF: 0.00 AC: 0 AN: 77828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 29388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5062

European-Non Finnish (NFE) AF: 0.00000296 AC: 3 AN: 1013034

Other (OTH) AF: 0.000176 AC: 9 AN: 51072

GnomAD4 genome AF: 0.000646 AC: 97 AN: 150066 Hom.: 0 Cov.: 0 AF XY: 0.000574 AC XY: 42 AN XY: 73222

African (AFR) AF: 0.00234 AC: 95 AN: 40668

American (AMR) AF: 0.0000660 AC: 1 AN: 15150

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3448

East Asian (EAS) AF: 0.00 AC: 0 AN: 5062

South Asian (SAS) AF: 0.00 AC: 0 AN: 4710

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10302

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67458

Other (OTH) AF: 0.000482 AC: 1 AN: 2076

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.97
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71156237; hg19: chr16-87637893;