16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The ENST00000301008.5(JPH3):n.732_733insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000301008.5 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- Huntington disease-like 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
JPH3 | NM_020655.4 | c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron_variant | Intron 1 of 4 | ENST00000284262.3 | NP_065706.2 | ||
JPH3 | NM_001271604.4 | c.472_473insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | p.Ala157_Val158insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 2 of 2 | NP_001258533.1 | ||
JPH3 | NM_001271605.3 | c.*170_*171insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | 3_prime_UTR_variant | Exon 2 of 2 | NP_001258534.1 | |||
JPH3 | NR_073379.3 | n.96+2399_96+2400insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron_variant | Intron 1 of 5 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
JPH3 | ENST00000301008.5 | n.732_733insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon_variant | Exon 2 of 2 | 1 | |||||
JPH3 | ENST00000284262.3 | c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron_variant | Intron 1 of 4 | 1 | NM_020655.4 | ENSP00000284262.2 | |||
JPH3 | ENST00000537256.5 | n.96+2399_96+2400insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron_variant | Intron 1 of 5 | 2 |
Frequencies
GnomAD3 genomes AF: 0.0000667 AC: 10AN: 149958Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000312 AC: 4AN: 1282838Hom.: 0 Cov.: 30 AF XY: 0.00000158 AC XY: 1AN XY: 633002 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000666 AC: 10AN: 150066Hom.: 0 Cov.: 0 AF XY: 0.0000819 AC XY: 6AN XY: 73222 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at