16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001271604.4(JPH3):c.472_473insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG(p.Ala157_Val158insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001271604.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Huntington disease-like 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001271604.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | NM_020655.4 | MANE Select | c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | NP_065706.2 | |||
| JPH3 | NM_001271604.4 | c.472_473insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | p.Ala157_Val158insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 2 of 2 | NP_001258533.1 | |||
| JPH3 | NM_001271605.3 | c.*170_*171insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | 3_prime_UTR | Exon 2 of 2 | NP_001258534.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | ENST00000284262.3 | TSL:1 MANE Select | c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | ENSP00000284262.2 | |||
| JPH3 | ENST00000301008.5 | TSL:1 | n.732_733insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon | Exon 2 of 2 | ||||
| JPH3 | ENST00000537256.5 | TSL:2 | n.96+2399_96+2400insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000333 AC: 5AN: 149958Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000390 AC: 5AN: 1282846Hom.: 0 Cov.: 30 AF XY: 0.00000632 AC XY: 4AN XY: 633004 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000400 AC: 6AN: 150066Hom.: 0 Cov.: 0 AF XY: 0.0000546 AC XY: 4AN XY: 73222 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at