17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-C
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_030665.4(RAI1):c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln283_Gln291del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000391 in 1,278,812 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. Q282Q) has been classified as Likely benign.
Frequency
Consequence
NM_030665.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Smith-Magenis syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), G2P
- Potocki-Lupski syndromeInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| RAI1 | ENST00000353383.6 | c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln283_Gln291del | disruptive_inframe_deletion | Exon 3 of 6 | 1 | NM_030665.4 | ENSP00000323074.4 | ||
| RAI1 | ENST00000395774.1 | c.846_872delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln283_Gln291del | disruptive_inframe_deletion | Exon 2 of 2 | 2 | ENSP00000379120.1 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 exome AF: 0.0000391 AC: 50AN: 1278812Hom.: 0 AF XY: 0.0000411 AC XY: 26AN XY: 632490 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 0
ClinVar
Submissions by phenotype
RAI1-related disorder Uncertain:1
The RAI1 c.846_872del27 variant is predicted to result in an in-frame deletion (p.Gln283_Gln291del). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
not provided Uncertain:1
This variant, c.846_872del, results in the deletion of 9 amino acid(s) of the RAI1 protein (p.Gln283_Gln291del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAI1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at