17-57979243-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGC
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_007146.3(VEZF1):c.1026_1046delGCAGCAGCAGCAGCAGCAGCA(p.Gln343_Gln349del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000239 in 150,760 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_007146.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autism spectrum disorderInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- cardiomyopathy, dilated, 100Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- dilated cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007146.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| VEZF1 | MANE Select | c.1026_1046delGCAGCAGCAGCAGCAGCAGCA | p.Gln343_Gln349del | disruptive_inframe_deletion | Exon 5 of 6 | NP_009077.2 | Q14119 | ||
| VEZF1 | c.999_1019delGCAGCAGCAGCAGCAGCAGCA | p.Gln334_Gln340del | disruptive_inframe_deletion | Exon 6 of 7 | NP_001317322.1 | J3QSH4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| VEZF1 | TSL:1 MANE Select | c.1026_1046delGCAGCAGCAGCAGCAGCAGCA | p.Gln343_Gln349del | disruptive_inframe_deletion | Exon 5 of 6 | ENSP00000462337.1 | Q14119 | ||
| VEZF1 | TSL:1 | c.480_500delGCAGCAGCAGCAGCAGCAGCA | p.Gln161_Gln167del | disruptive_inframe_deletion | Exon 4 of 5 | ENSP00000258963.3 | J9JIC7 | ||
| VEZF1 | c.1167_1187delGCAGCAGCAGCAGCAGCAGCA | p.Gln390_Gln396del | disruptive_inframe_deletion | Exon 6 of 7 | ENSP00000575231.1 |
Frequencies
GnomAD3 genomes AF: 0.000239 AC: 36AN: 150648Hom.: 0 Cov.: 28 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000272 AC: 394AN: 1446326Hom.: 0 AF XY: 0.000254 AC XY: 183AN XY: 719524 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000239 AC: 36AN: 150760Hom.: 0 Cov.: 28 AF XY: 0.000217 AC XY: 16AN XY: 73668 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at