17-57979243-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGC

Variant names:

• chr17-57979243-TTGCTGCTGCTGCTGCTGCTGC-T
• rs57786397
• NM_007146.3:c.1026_1046delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_007146.3(VEZF1):​c.1026_1046delGCAGCAGCAGCAGCAGCAGCA​(p.Gln343_Gln349del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000239 in 150,760 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00024 (0 hom., cov: 28)
  • Exomes 𝑓: 0.00027 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: VEZF1 NM_007146.3 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.35
• Publications: 1 publications found

Genes affected

VEZF1 (HGNC:12949): (vascular endothelial zinc finger 1) Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]

VEZF1 Gene-Disease associations (from GenCC):

• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• cardiomyopathy, dilated, 100

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• dilated cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007146.3
• BS2: High AC in GnomAd4 at 36 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007146.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VEZF1	NM_007146.3	MANE Select	c.1026_1046delGCAGCAGCAGCAGCAGCAGCA	p.Gln343_Gln349del	disruptive_inframe_deletion	Exon 5 of 6	NP_009077.2	Q14119
	VEZF1	NM_001330393.2		c.999_1019delGCAGCAGCAGCAGCAGCAGCA	p.Gln334_Gln340del	disruptive_inframe_deletion	Exon 6 of 7	NP_001317322.1	J3QSH4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VEZF1	ENST00000581208.2	TSL:1 MANE Select	c.1026_1046delGCAGCAGCAGCAGCAGCAGCA	p.Gln343_Gln349del	disruptive_inframe_deletion	Exon 5 of 6	ENSP00000462337.1	Q14119
	VEZF1	ENST00000258963.7	TSL:1	c.480_500delGCAGCAGCAGCAGCAGCAGCA	p.Gln161_Gln167del	disruptive_inframe_deletion	Exon 4 of 5	ENSP00000258963.3	J9JIC7
	VEZF1	ENST00000905172.1		c.1167_1187delGCAGCAGCAGCAGCAGCAGCA	p.Gln390_Gln396del	disruptive_inframe_deletion	Exon 6 of 7	ENSP00000575231.1

Frequencies

GnomAD3 genomes AF: 0.000239 AC: 36 AN: 150648 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.000196

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000265

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000387

Gnomad SAS AF: 0.000421

Gnomad FIN AF: 0.0000959

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000281

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000272 AC: 394 AN: 1446326 Hom.: 0 AF XY: 0.000254 AC XY: 183 AN XY: 719524

African (AFR) AF: 0.000273 AC: 9 AN: 32928

American (AMR) AF: 0.000158 AC: 7 AN: 44326

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25812

East Asian (EAS) AF: 0.000382 AC: 15 AN: 39308

South Asian (SAS) AF: 0.000130 AC: 11 AN: 84802

European-Finnish (FIN) AF: 0.0000950 AC: 5 AN: 52616

Middle Eastern (MID) AF: 0.000177 AC: 1 AN: 5636

European-Non Finnish (NFE) AF: 0.000304 AC: 335 AN: 1101232

Other (OTH) AF: 0.000184 AC: 11 AN: 59666

GnomAD4 genome AF: 0.000239 AC: 36 AN: 150760 Hom.: 0 Cov.: 28 AF XY: 0.000217 AC XY: 16 AN XY: 73668

African (AFR) AF: 0.000196 AC: 8 AN: 40900

American (AMR) AF: 0.000264 AC: 4 AN: 15142

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3446

East Asian (EAS) AF: 0.000387 AC: 2 AN: 5162

South Asian (SAS) AF: 0.000421 AC: 2 AN: 4752

European-Finnish (FIN) AF: 0.0000959 AC: 1 AN: 10432

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.000281 AC: 19 AN: 67638

Other (OTH) AF: 0.00 AC: 0 AN: 2086

Alfa AF: 0.00 Hom.: 68

Bravo AF: 0.000196

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.3
Mutation Taster		=152/48	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs57786397; hg19: chr17-56056604;