18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-G-GAGCAGCAGCAGC
• rs55725917
• NM_001083962.2:c.73-813_73-802dupGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-813_73-802dupGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0054 (14 hom., cov: 0)
  • Exomes 𝑓: 0.0072 (118 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.00538 (729/135528) while in subpopulation EAS AF= 0.0194 (85/4382). AF 95% confidence interval is 0.0161. There are 14 homozygotes in gnomad4. There are 363 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 729 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-813_73-802dupGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-813_73-802dupGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.00539 AC: 730 AN: 135436 Hom.: 14 Cov.: 0

Gnomad AFR AF: 0.00429

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00371

Gnomad ASJ AF: 0.0129

Gnomad EAS AF: 0.0194

Gnomad SAS AF: 0.0128

Gnomad FIN AF: 0.00636

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.00449

Gnomad OTH AF: 0.00485

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00716 AC: 4096 AN: 571902 Hom.: 118 Cov.: 0 AF XY: 0.00771 AC XY: 2302 AN XY: 298748

Gnomad4 AFR exome AF: 0.00394

Gnomad4 AMR exome AF: 0.00341

Gnomad4 ASJ exome AF: 0.0149

Gnomad4 EAS exome AF: 0.0339

Gnomad4 SAS exome AF: 0.0145

Gnomad4 FIN exome AF: 0.0145

Gnomad4 NFE exome AF: 0.00402

Gnomad4 OTH exome AF: 0.00826

GnomAD4 genome AF: 0.00538 AC: 729 AN: 135528 Hom.: 14 Cov.: 0 AF XY: 0.00554 AC XY: 363 AN XY: 65542

Gnomad4 AFR AF: 0.00428

Gnomad4 AMR AF: 0.00371

Gnomad4 ASJ AF: 0.0129

Gnomad4 EAS AF: 0.0194

Gnomad4 SAS AF: 0.0128

Gnomad4 FIN AF: 0.00636

Gnomad4 NFE AF: 0.00449

Gnomad4 OTH AF: 0.00480

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;