18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr18-55586153-G-GAGCAGCAGCAGCAGC
• rs55725917
• NM_001083962.2:c.73-816_73-802dupGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-816_73-802dupGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0051 (14 hom., cov: 0)
  • Exomes 𝑓: 0.0061 (91 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.00512 (694/135506) while in subpopulation EAS AF= 0.0116 (51/4380). AF 95% confidence interval is 0.0091. There are 14 homozygotes in gnomad4. There are 335 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 694 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-816_73-802dupGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-816_73-802dupGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.00512 AC: 693 AN: 135414 Hom.: 14 Cov.: 0

Gnomad AFR AF: 0.00455

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00425

Gnomad ASJ AF: 0.0202

Gnomad EAS AF: 0.0118

Gnomad SAS AF: 0.00952

Gnomad FIN AF: 0.00537

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.00415

Gnomad OTH AF: 0.00431

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00607 AC: 3473 AN: 571812 Hom.: 91 Cov.: 0 AF XY: 0.00628 AC XY: 1877 AN XY: 298730

Gnomad4 AFR exome AF: 0.00372

Gnomad4 AMR exome AF: 0.00382

Gnomad4 ASJ exome AF: 0.0179

Gnomad4 EAS exome AF: 0.0174

Gnomad4 SAS exome AF: 0.00849

Gnomad4 FIN exome AF: 0.00797

Gnomad4 NFE exome AF: 0.00462

Gnomad4 OTH exome AF: 0.00707

GnomAD4 genome AF: 0.00512 AC: 694 AN: 135506 Hom.: 14 Cov.: 0 AF XY: 0.00511 AC XY: 335 AN XY: 65534

Gnomad4 AFR AF: 0.00459

Gnomad4 AMR AF: 0.00425

Gnomad4 ASJ AF: 0.0202

Gnomad4 EAS AF: 0.0116

Gnomad4 SAS AF: 0.00928

Gnomad4 FIN AF: 0.00537

Gnomad4 NFE AF: 0.00415

Gnomad4 OTH AF: 0.00480

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;