18-657645-ACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG-A
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001071.4(TYMS):c.-86_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000887 in 1,002,936 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001071.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| TYMS | NM_001071.4 | c.-86_-31delGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTT | 5_prime_UTR_variant | Exon 1 of 7 | ENST00000323274.15 | NP_001062.1 | ||
| TYMS | NM_001071.4 | c.-97_-42delCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG | upstream_gene_variant | ENST00000323274.15 | NP_001062.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| TYMS | ENST00000323274.15 | c.-97_-42delCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG | 5_prime_UTR_variant | Exon 1 of 7 | 1 | NM_001071.4 | ENSP00000315644.10 | |||
| TYMS | ENST00000323274.15 | c.-97_-42delCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG | non_coding_transcript_variant | 1 | NM_001071.4 | ENSP00000315644.10 | ||||
| TYMS | ENST00000323274.15 | c.-97_-42delCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCG | upstream_gene_variant | 1 | NM_001071.4 | ENSP00000315644.10 |
Frequencies
GnomAD3 genomes AF: 0.000108 AC: 16AN: 148234Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000854 AC: 73AN: 854598Hom.: 0 AF XY: 0.0000833 AC XY: 35AN XY: 420322 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000108 AC: 16AN: 148338Hom.: 0 Cov.: 0 AF XY: 0.0000967 AC XY: 7AN XY: 72410 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at