19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTG

Variant names:

• chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTG-C
• rs16054
• NM_001127222.2:c.6952_6975delCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001127222.2(CACNA1A):​c.6952_6975delCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln2318_Gln2325del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000433 in 1,431,820 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000027 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000045 (0 hom.)
• Consequence: CACNA1A NM_001127222.2 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.785
• Publications: 10 publications found

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

CACNA1A Gene-Disease associations (from GenCC):

• episodic ataxia type 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp, Orphanet
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Illumina, Orphanet
• developmental and epileptic encephalopathy, 42

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• migraine, familial hemiplegic, 1

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• spinocerebellar ataxia type 6

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• benign paroxysmal torticollis of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial or sporadic hemiplegic migraine

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Lennox-Gastaut syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000300728 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001127222.2
• BS2: High AC in GnomAdExome4 at 58 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001127222.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1A	NM_001127222.2	MANE Select	c.6952_6975delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2325del	conservative_inframe_deletion	Exon 47 of 47	NP_001120694.1	O00555-8
	CACNA1A	NM_001127221.2	MANE Plus Clinical	c.*164_*187delCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR	Exon 47 of 47	NP_001120693.1	O00555-3
	CACNA1A	NM_023035.3		c.6970_6993delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2324_Gln2331del	conservative_inframe_deletion	Exon 48 of 48	NP_075461.2	A0A087WW63

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1A	ENST00000360228.11	TSL:1 MANE Select	c.6952_6975delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2325del	conservative_inframe_deletion	Exon 47 of 47	ENSP00000353362.5	O00555-8
	CACNA1A	ENST00000638029.1	TSL:5	c.6970_6993delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2324_Gln2331del	conservative_inframe_deletion	Exon 48 of 48	ENSP00000489829.1	A0A087WW63
	CACNA1A	ENST00000573710.7	TSL:5	c.6958_6981delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2320_Gln2327del	conservative_inframe_deletion	Exon 47 of 47	ENSP00000460092.3	A0A1C7CYY9

Frequencies

GnomAD3 genomes AF: 0.0000271 AC: 4 AN: 147800 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000600

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000452 AC: 58 AN: 1283918 Hom.: 0 AF XY: 0.0000522 AC XY: 33 AN XY: 631934

African (AFR) AF: 0.00 AC: 0 AN: 24930

American (AMR) AF: 0.000291 AC: 7 AN: 24096

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21718

East Asian (EAS) AF: 0.000135 AC: 4 AN: 29594

South Asian (SAS) AF: 0.0000152 AC: 1 AN: 65604

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 33418

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3752

European-Non Finnish (NFE) AF: 0.0000438 AC: 45 AN: 1027664

Other (OTH) AF: 0.0000188 AC: 1 AN: 53142

GnomAD4 genome AF: 0.0000270 AC: 4 AN: 147902 Hom.: 0 Cov.: 0 AF XY: 0.0000417 AC XY: 3 AN XY: 72002

African (AFR) AF: 0.00 AC: 0 AN: 40206

American (AMR) AF: 0.00 AC: 0 AN: 14968

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3436

East Asian (EAS) AF: 0.00 AC: 0 AN: 4816

South Asian (SAS) AF: 0.00 AC: 0 AN: 4704

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9952

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 276

European-Non Finnish (NFE) AF: 0.0000601 AC: 4 AN: 66604

Other (OTH) AF: 0.00 AC: 0 AN: 2044

Alfa AF: 0.00 Hom.: 195

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.79
Mutation Taster		=190/10	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs16054; hg19: chr19-13318672;