2-47806837-C-CTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000179.3(MSH6):c.4061_*23dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene MSH6 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000179.3 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | MANE Select | c.4061_*23dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | NP_000170.1 | P52701-1 | |||
| MSH6 | c.4157_*23dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 11 of 11 | NP_001393724.1 | |||||
| MSH6 | c.4067_*23dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | NP_001393742.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | TSL:1 MANE Select | c.4061_*23dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | ENSP00000234420.5 | P52701-1 | |||
| MSH6 | TSL:1 | n.*3408_*3453dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | non_coding_transcript_exon | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 | |||
| MSH6 | TSL:1 | n.*3408_*3453dupTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at