20-63696707-TCAGGCACAGCAGGGTCCTGTGTCCGCGCTGAGCCGCGCTCTCCCTGCTCCAGCAAGGACCATGAGGGCGCTGGAGGGGCCAGGCCTGTCGCTGCTGTGCCTGGTGTTGGCGCTGCCTGCCCTGCTGCCGGTGCCGGCTGTACGCGGAGTGGCAGAAACACCCACCTACCCCTGGCGGGACGCAGAGACAGGGGAGCGGCTGGTGTGCGCCCAGTGCCCCC-T

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The ENST00000492259.6(RTEL1-TNFRSF6B):​n.*1332-45_*1506del variant causes a splice acceptor, splice region, 3 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 34)

Consequence

RTEL1-TNFRSF6B
ENST00000492259.6 splice_acceptor, splice_region, 3_prime_UTR, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: -0.0930

Publications

0 publications found
Variant links:
Genes affected
TNFRSF6B (HGNC:11921): (TNF receptor superfamily member 6b) This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011]
RTEL1-TNFRSF6B (HGNC:44095): (RTEL1-TNFRSF6B readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring RTEL1 (regulator of telomere elongation helicase 1) and TNFRSF6B (tumor necrosis factor receptor superfamily, member 6b, decoy) genes on chromosome 20. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Feb 2011]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.18320611 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TNFRSF6BNM_003823.4 linkc.-53_167del p.Met1fs frameshift_variant, start_lost Exon 1 of 3 ENST00000369996.3 NP_003814.1 O95407
TNFRSF6BNM_003823.4 linkc.-53_167del 5_prime_UTR_variant Exon 1 of 3 ENST00000369996.3 NP_003814.1 O95407
RTEL1-TNFRSF6BNR_037882.1 linkn.4727-45_4901del splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant Exon 36 of 38

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TNFRSF6BENST00000369996.3 linkc.-53_167del p.Met1fs frameshift_variant, start_lost Exon 1 of 3 1 NM_003823.4 ENSP00000359013.1 O95407
RTEL1-TNFRSF6BENST00000492259.6 linkn.*1332-45_*1506del splice_region_variant, non_coding_transcript_exon_variant Exon 33 of 35 5 ENSP00000457428.1 D6RA96
TNFRSF6BENST00000369996.3 linkc.-53_167del 5_prime_UTR_variant Exon 1 of 3 1 NM_003823.4 ENSP00000359013.1 O95407
RTEL1-TNFRSF6BENST00000492259.6 linkn.*1332-45_*1506del splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant Exon 33 of 35 5 ENSP00000457428.1 D6RA96

Frequencies

GnomAD3 genomes
Cov.:
34
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
34

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Sep 24, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change affects the initiator methionine of the TNFRSF6B mRNA. The next in-frame methionine is located at codon 285. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TNFRSF6B-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
-0.093

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

hg19: chr20-62328060; API