22-45795354-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT

Variant names:

• chr22-45795354-G-GATTCTATTCT
• rs60726084
• NM_013236.4:c.1174-11544_1174-11535dupATTCTATTCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_013236.4(ATXN10):​c.1174-11544_1174-11535dupATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.033 (156 hom., cov: 0)
• Consequence: ATXN10 NM_013236.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.237
• Publications: 1 publications found

Genes affected

ATXN10 (HGNC:10549): (ataxin 10) This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

ATXN10 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 10

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0968 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN10	NM_013236.4	c.1174-11544_1174-11535dupATTCTATTCT		intron_variant	Intron 9 of 11	ENST00000252934.10	NP_037368.1
ATXN10	NM_001167621.2	c.982-11544_982-11535dupATTCTATTCT		intron_variant	Intron 8 of 10		NP_001161093.1
ATXN10	XM_047441314.1	c.1174-11544_1174-11535dupATTCTATTCT		intron_variant	Intron 9 of 11		XP_047297270.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN10	ENST00000252934.10	c.1174-11605_1174-11604insATTCTATTCT		intron_variant	Intron 9 of 11	1	NM_013236.4	ENSP00000252934.4

Frequencies

GnomAD3 genomes AF: 0.0331 AC: 4182 AN: 126496 Hom.: 156 Cov.: 0

Gnomad AFR AF: 0.0273

Gnomad AMI AF: 0.0233

Gnomad AMR AF: 0.0301

Gnomad ASJ AF: 0.0296

Gnomad EAS AF: 0.105

Gnomad SAS AF: 0.0375

Gnomad FIN AF: 0.0518

Gnomad MID AF: 0.0655

Gnomad NFE AF: 0.0295

Gnomad OTH AF: 0.0300

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0331 AC: 4188 AN: 126602 Hom.: 156 Cov.: 0 AF XY: 0.0344 AC XY: 2095 AN XY: 60820

African (AFR) AF: 0.0273 AC: 911 AN: 33320

American (AMR) AF: 0.0300 AC: 370 AN: 12346

Ashkenazi Jewish (ASJ) AF: 0.0296 AC: 91 AN: 3076

East Asian (EAS) AF: 0.105 AC: 423 AN: 4026

South Asian (SAS) AF: 0.0375 AC: 136 AN: 3626

European-Finnish (FIN) AF: 0.0518 AC: 411 AN: 7936

Middle Eastern (MID) AF: 0.0735 AC: 20 AN: 272

European-Non Finnish (NFE) AF: 0.0295 AC: 1753 AN: 59470

Other (OTH) AF: 0.0315 AC: 54 AN: 1714

Alfa AF: 0.0267 Hom.: 99

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.24
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60726084; hg19: chr22-46191234; COSMIC: COSV53298734; COSMIC: COSV53298734;