3-141487086-GGCGGCGGCGGCGCCTGCTGCT-GGCGGCGGCGGCGCCTGCTGCTGCGGCGGCGGCGCCTGCTGCT
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4BP6BS2
The NM_006506.5(RASA2):c.12_32dupGGCGCCTGCTGCTGCGGCGGC(p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000338 in 1,357,036 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_006506.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Noonan syndromeInheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
- cardiofaciocutaneous syndromeInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Costello syndromeInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome with multiple lentiginesInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome-like disorder with loose anagen hairInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006506.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RASA2 | MANE Select | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | NP_006497.2 | |||
| RASA2 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 25 | NP_001290175.1 | ||||
| RASA2 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | NP_001290174.1 | Q15283-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RASA2 | TSL:1 MANE Select | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | ENSP00000286364.3 | Q15283-2 | ||
| RASA2 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 25 | ENSP00000600752.1 | ||||
| RASA2 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 25 | ENSP00000620186.1 |
Frequencies
GnomAD3 genomes AF: 0.00138 AC: 207AN: 150376Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000178 AC: 1AN: 56244 AF XY: 0.0000318 show subpopulations
GnomAD4 exome AF: 0.000208 AC: 251AN: 1206552Hom.: 0 Cov.: 31 AF XY: 0.000203 AC XY: 120AN XY: 591784 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00138 AC: 207AN: 150484Hom.: 0 Cov.: 32 AF XY: 0.00133 AC XY: 98AN XY: 73528 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at