3-63912684-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chr3-63912684-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001377405.1(ATXN7):​c.98_118dupAGCAGCAGCAGCAGCAGCAGC​(p.Gln33_Gln39dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.00022 in 1,087,142 control chromosomes in the GnomAD database, including 1 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00054 (0 hom., cov: 23)
  • Exomes 𝑓: 0.00017 (1 hom.)
• Consequence: ATXN7 NM_001377405.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.10

Genes affected

ATXN7 (HGNC:10560): (ataxin 7) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001377405.1
• BS2: High AC in GnomAd4 at 78 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN7	NM_001377405.1	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	3/13	ENST00000674280.1	NP_001364334.1
ATXN7	NM_001177387.1	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	2/13		NP_001170858.1
ATXN7	NM_000333.4	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	3/13		NP_000324.1
ATXN7	NM_001377406.1	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	2/12		NP_001364335.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN7	ENST00000674280.1	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	3/13		NM_001377405.1	ENSP00000501377.1

Frequencies

GnomAD3 genomes AF: 0.000532 AC: 77 AN: 144614 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.00170

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000136

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000764

Gnomad OTH AF: 0.000996

GnomAD4 exome AF: 0.000171 AC: 161 AN: 942426 Hom.: 1 Cov.: 26 AF XY: 0.000166 AC XY: 74 AN XY: 446584

Gnomad4 AFR exome AF: 0.00237

Gnomad4 AMR exome AF: 0.000189

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000250

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000127

Gnomad4 OTH exome AF: 0.000242

GnomAD4 genome AF: 0.000539 AC: 78 AN: 144716 Hom.: 0 Cov.: 23 AF XY: 0.000497 AC XY: 35 AN XY: 70410

Gnomad4 AFR AF: 0.00173

Gnomad4 AMR AF: 0.000136

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000764

Gnomad4 OTH AF: 0.000985

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922929; hg19: chr3-63898360;