3-63912684-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr3-63912684-G-GGCAGCAGCAGCAGCAGCAGCA
• rs193922929
• NM_001377405.1:c.98_118dupAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001377405.1(ATXN7):​c.98_118dupAGCAGCAGCAGCAGCAGCAGC​(p.Gln33_Gln39dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.00022 in 1,087,142 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00054 (0 hom., cov: 23)
  • Exomes 𝑓: 0.00017 (1 hom.)
• Consequence: ATXN7 NM_001377405.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.10
• Publications: 0 publications found

Genes affected

ATXN7 (HGNC:10560): (ataxin 7) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

ATXN7 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia 7

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• spinocerebellar ataxia type 7

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001377405.1
• BS2: High AC in GnomAd4 at 78 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001377405.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	NM_001377405.1	MANE Select	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	NP_001364334.1	O15265-1
	ATXN7	NM_001177387.1		c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 2 of 13	NP_001170858.1	O15265-2
	ATXN7	NM_000333.4		c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	NP_000324.1	O15265-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	ENST00000674280.1	MANE Select	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000501377.1	O15265-1
	ATXN7	ENST00000295900.10	TSL:1	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000295900.6	O15265-1
	ATXN7	ENST00000522345.2	TSL:2	c.98_118dupAGCAGCAGCAGCAGCAGCAGC	p.Gln33_Gln39dup	disruptive_inframe_insertion	Exon 1 of 12	ENSP00000428067.2	O15265-2

Frequencies

GnomAD3 genomes AF: 0.000532 AC: 77 AN: 144614 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.00170

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000136

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000764

Gnomad OTH AF: 0.000996

GnomAD4 exome AF: 0.000171 AC: 161 AN: 942426 Hom.: 1 Cov.: 26 AF XY: 0.000166 AC XY: 74 AN XY: 446584

African (AFR) AF: 0.00237 AC: 42 AN: 17710

American (AMR) AF: 0.000189 AC: 1 AN: 5282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 8402

East Asian (EAS) AF: 0.00 AC: 0 AN: 9614

South Asian (SAS) AF: 0.000250 AC: 5 AN: 20022

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 18856

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2096

European-Non Finnish (NFE) AF: 0.000127 AC: 105 AN: 827340

Other (OTH) AF: 0.000242 AC: 8 AN: 33104

GnomAD4 genome AF: 0.000539 AC: 78 AN: 144716 Hom.: 0 Cov.: 23 AF XY: 0.000497 AC XY: 35 AN XY: 70410

African (AFR) AF: 0.00173 AC: 69 AN: 39996

American (AMR) AF: 0.000136 AC: 2 AN: 14702

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3374

East Asian (EAS) AF: 0.00 AC: 0 AN: 4766

South Asian (SAS) AF: 0.00 AC: 0 AN: 4708

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8512

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.0000764 AC: 5 AN: 65440

Other (OTH) AF: 0.000985 AC: 2 AN: 2030

Alfa AF: 0.00 Hom.: 39

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=68/32	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922929; hg19: chr3-63898360;