3-63912684-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs193922929
• NM_001377405.1:c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001377405.1(ATXN7):​c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.00000212 in 942,434 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 23)
  • Exomes 𝑓: 0.0000021 (1 hom.)
• Consequence: ATXN7 NM_001377405.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.10
• Publications: 0 publications found

Genes affected

ATXN7 (HGNC:10560): (ataxin 7) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

ATXN7 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia 7

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• spinocerebellar ataxia type 7

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001377405.1

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001377405.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	NM_001377405.1	MANE Select	c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 3 of 13	NP_001364334.1	O15265-1
	ATXN7	NM_001177387.1		c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 2 of 13	NP_001170858.1	O15265-2
	ATXN7	NM_000333.4		c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 3 of 13	NP_000324.1	O15265-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN7	ENST00000674280.1	MANE Select	c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000501377.1	O15265-1
	ATXN7	ENST00000295900.10	TSL:1	c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 3 of 13	ENSP00000295900.6	O15265-1
	ATXN7	ENST00000522345.2	TSL:2	c.118_119insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln39_Pro40insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 1 of 12	ENSP00000428067.2	O15265-2

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome AF: 0.00000212 AC: 2 AN: 942434 Hom.: 1 Cov.: 26 AF XY: 0.00 AC XY: 0 AN XY: 446588

African (AFR) AF: 0.00 AC: 0 AN: 17716

American (AMR) AF: 0.000379 AC: 2 AN: 5282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 8402

East Asian (EAS) AF: 0.00 AC: 0 AN: 9614

South Asian (SAS) AF: 0.00 AC: 0 AN: 20022

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 18856

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2096

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 827342

Other (OTH) AF: 0.00 AC: 0 AN: 33104

GnomAD4 genome Cov.: 23

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922929; hg19: chr3-63898360;