4-139889909-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_018717.5(MAML3):c.1509_1526dupGCAGCAGCAGCAGCAGCA(p.Gln504_Gln509dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_018717.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018717.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MAML3 | NM_018717.5 | MANE Select | c.1509_1526dupGCAGCAGCAGCAGCAGCA | p.Gln504_Gln509dup | disruptive_inframe_insertion | Exon 2 of 5 | NP_061187.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MAML3 | ENST00000509479.6 | TSL:1 MANE Select | c.1509_1526dupGCAGCAGCAGCAGCAGCA | p.Gln504_Gln509dup | disruptive_inframe_insertion | Exon 2 of 5 | ENSP00000421180.1 | Q96JK9 | |
| MAML3 | ENST00000899537.1 | c.1509_1526dupGCAGCAGCAGCAGCAGCA | p.Gln504_Gln509dup | disruptive_inframe_insertion | Exon 2 of 5 | ENSP00000569596.1 | |||
| MAML3 | ENST00000502696.1 | TSL:2 | c.109-159260_109-159243dupGCAGCAGCAGCAGCAGCA | intron | N/A | ENSP00000422783.1 | H0Y920 |
Frequencies
GnomAD3 genomes AF: 0.0000836 AC: 4AN: 47822Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000378 AC: 54AN: 1428740Hom.: 0 Cov.: 0 AF XY: 0.0000466 AC XY: 33AN XY: 707952 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000835 AC: 4AN: 47910Hom.: 0 Cov.: 0 AF XY: 0.0000850 AC XY: 2AN XY: 23536 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at