4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs71180116
• NM_001388492.1:c.63_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS1

The NM_001388492.1(HTT):​c.63_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln22_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00029 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00012 (3 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.000288 (38/131880) while in subpopulation NFE AF = 0.000342 (21/61484). AF 95% confidence interval is 0.000229. There are 0 homozygotes in GnomAd4. There are 13 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.63_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln22_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.63_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln22_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.63_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln22_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes AF: 0.000288 AC: 38 AN: 131782 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000254

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000224

Gnomad ASJ AF: 0.000313

Gnomad EAS AF: 0.000242

Gnomad SAS AF: 0.000256

Gnomad FIN AF: 0.000271

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000341

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000123 AC: 151 AN: 1225838 Hom.: 3 Cov.: 0 AF XY: 0.000122 AC XY: 74 AN XY: 608136

African (AFR) AF: 0.0000387 AC: 1 AN: 25814

American (AMR) AF: 0.000165 AC: 5 AN: 30304

Ashkenazi Jewish (ASJ) AF: 0.000132 AC: 3 AN: 22734

East Asian (EAS) AF: 0.0000687 AC: 2 AN: 29094

South Asian (SAS) AF: 0.000194 AC: 14 AN: 72230

European-Finnish (FIN) AF: 0.0000923 AC: 3 AN: 32500

Middle Eastern (MID) AF: 0.000264 AC: 1 AN: 3782

European-Non Finnish (NFE) AF: 0.000116 AC: 111 AN: 957546

Other (OTH) AF: 0.000212 AC: 11 AN: 51834

GnomAD4 genome AF: 0.000288 AC: 38 AN: 131880 Hom.: 0 Cov.: 0 AF XY: 0.000205 AC XY: 13 AN XY: 63424

African (AFR) AF: 0.000253 AC: 9 AN: 35524

American (AMR) AF: 0.000224 AC: 3 AN: 13412

Ashkenazi Jewish (ASJ) AF: 0.000313 AC: 1 AN: 3190

East Asian (EAS) AF: 0.000242 AC: 1 AN: 4124

South Asian (SAS) AF: 0.000256 AC: 1 AN: 3910

European-Finnish (FIN) AF: 0.000271 AC: 2 AN: 7368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 252

European-Non Finnish (NFE) AF: 0.000342 AC: 21 AN: 61484

Other (OTH) AF: 0.00 AC: 0 AN: 1816

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;