5-146878727-AGCTGCTGCTGCTGCTGCTGCTGCT-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs10591869
• ENST00000530902.5:n.167_168insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000530902.5(PPP2R2B):​n.167_168insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000022 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PPP2R2B ENST00000530902.5 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.19
• Publications: 4 publications found

Genes affected

PPP2R2B (HGNC:9305): (protein phosphatase 2 regulatory subunit Bbeta) The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

PPP2R2B Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 12

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PPP2R2B	NM_181675.4	c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000394411.9	NP_858061.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PPP2R2B	ENST00000394411.9	c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	2	NM_181675.4	ENSP00000377933.3

Frequencies

GnomAD3 genomes AF: 0.0000199 AC: 3 AN: 150488 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000245

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000296

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000218 AC: 25 AN: 1146998 Hom.: 0 Cov.: 27 AF XY: 0.0000213 AC XY: 12 AN XY: 562106

African (AFR) AF: 0.0000852 AC: 2 AN: 23470

American (AMR) AF: 0.00 AC: 0 AN: 27150

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15244

East Asian (EAS) AF: 0.000252 AC: 6 AN: 23796

South Asian (SAS) AF: 0.0000689 AC: 5 AN: 72538

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 15564

Middle Eastern (MID) AF: 0.000351 AC: 1 AN: 2848

European-Non Finnish (NFE) AF: 0.0000108 AC: 10 AN: 923474

Other (OTH) AF: 0.0000233 AC: 1 AN: 42914

GnomAD4 genome AF: 0.0000199 AC: 3 AN: 150606 Hom.: 0 Cov.: 0 AF XY: 0.0000272 AC XY: 2 AN XY: 73474

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000244 AC: 1 AN: 41004

American (AMR) AF: 0.00 AC: 0 AN: 15176

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3460

East Asian (EAS) AF: 0.00 AC: 0 AN: 4910

South Asian (SAS) AF: 0.00 AC: 0 AN: 4700

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10442

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000296 AC: 2 AN: 67634

Other (OTH) AF: 0.00 AC: 0 AN: 2088

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs10591869; hg19: chr5-146258290;