5-146878727-AGCTGCTGCTGCTGCTGCTGCTGCT-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000530902.5(PPP2R2B):n.167_168insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000530902.5 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 12Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PPP2R2B | NM_181675.4 | c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR_variant | Exon 1 of 10 | ENST00000394411.9 | NP_858061.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| PPP2R2B | ENST00000394411.9 | c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR_variant | Exon 1 of 10 | 2 | NM_181675.4 | ENSP00000377933.3 |
Frequencies
GnomAD3 genomes AF: 0.0000133 AC: 2AN: 150488Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000139 AC: 16AN: 1147000Hom.: 2 Cov.: 27 AF XY: 0.0000196 AC XY: 11AN XY: 562106 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000133 AC: 2AN: 150488Hom.: 0 Cov.: 0 AF XY: 0.0000273 AC XY: 2AN XY: 73346 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at