6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-A

Variant names:

• chr6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs752404282
• NM_003194.5:c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_003194.5(TBP):​c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln77_Gln94del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000159 in 1,261,704 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q76Q) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 21)
  • Exomes 𝑓: 0.0000016 (0 hom.)
• Consequence: TBP NM_003194.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.03
• Publications: 0 publications found

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

TBP Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 17

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003194.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003194.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	NM_003194.5	MANE Select	c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln77_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	NP_003185.1
	TBP	NM_001172085.2		c.168_221delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln57_Gln74del	disruptive_inframe_deletion	Exon 2 of 7	NP_001165556.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	ENST00000392092.7	TSL:1 MANE Select	c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln77_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000375942.2
	TBP	ENST00000230354.10	TSL:1	c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln77_Gln94del	disruptive_inframe_deletion	Exon 3 of 8	ENSP00000230354.5
	TBP	ENST00000421512.5	TSL:1	c.228_281delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln77_Gln94del	disruptive_inframe_deletion	Exon 3 of 5	ENSP00000400008.1

Frequencies

GnomAD3 genomes Cov.: 21

GnomAD4 exome AF: 0.00000159 AC: 2 AN: 1261704 Hom.: 0 AF XY: 0.00000317 AC XY: 2 AN XY: 630696

African (AFR) AF: 0.00 AC: 0 AN: 28776

American (AMR) AF: 0.00 AC: 0 AN: 41894

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23728

East Asian (EAS) AF: 0.00 AC: 0 AN: 38406

South Asian (SAS) AF: 0.00 AC: 0 AN: 81728

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46476

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4954

European-Non Finnish (NFE) AF: 0.00000212 AC: 2 AN: 941844

Other (OTH) AF: 0.00 AC: 0 AN: 53898

GnomAD4 genome Cov.: 21

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;