6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr6-170561958-A-ACAGCAGCAGCAGCAGCAGCAG
• rs752404282
• NM_003194.5:c.261_281dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3 BS2_Supporting

The ENST00000392092.7(TBP):​c.261_281dupGCAGCAGCAGCAGCAGCAGCA​(p.Gln88_Gln94dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000391 in 1,405,074 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00010 (0 hom., cov: 24)
  • Exomes 𝑓: 0.000032 (0 hom.)
• Consequence: TBP ENST00000392092.7 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.290
• Publications: 4 publications found

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

TBP Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 17

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000392092.7
• BS2: High AC in GnomAd4 at 15 AD gene. Variant has AC lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000392092.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	NM_003194.5	MANE Select	c.261_281dupGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94dup	disruptive_inframe_insertion	Exon 3 of 8	NP_003185.1
	TBP	NM_001172085.2		c.201_221dupGCAGCAGCAGCAGCAGCAGCA	p.Gln68_Gln74dup	disruptive_inframe_insertion	Exon 2 of 7	NP_001165556.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TBP	ENST00000392092.7	TSL:1 MANE Select	c.261_281dupGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94dup	disruptive_inframe_insertion	Exon 3 of 8	ENSP00000375942.2
	TBP	ENST00000230354.10	TSL:1	c.261_281dupGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94dup	disruptive_inframe_insertion	Exon 3 of 8	ENSP00000230354.5
	TBP	ENST00000421512.5	TSL:1	c.261_281dupGCAGCAGCAGCAGCAGCAGCA	p.Gln88_Gln94dup	disruptive_inframe_insertion	Exon 3 of 5	ENSP00000400008.1

Frequencies

GnomAD3 genomes AF: 0.000105 AC: 15 AN: 143372 Hom.: 0 Cov.: 24

Gnomad AFR AF: 0.000102

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000200

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000141

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000317 AC: 40 AN: 1261702 Hom.: 0 Cov.: 0 AF XY: 0.0000301 AC XY: 19 AN XY: 630696

African (AFR) AF: 0.00 AC: 0 AN: 28776

American (AMR) AF: 0.00 AC: 0 AN: 41894

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23728

East Asian (EAS) AF: 0.0000260 AC: 1 AN: 38406

South Asian (SAS) AF: 0.0000122 AC: 1 AN: 81728

European-Finnish (FIN) AF: 0.000151 AC: 7 AN: 46476

Middle Eastern (MID) AF: 0.000202 AC: 1 AN: 4954

European-Non Finnish (NFE) AF: 0.0000297 AC: 28 AN: 941842

Other (OTH) AF: 0.0000371 AC: 2 AN: 53898

GnomAD4 genome AF: 0.000105 AC: 15 AN: 143372 Hom.: 0 Cov.: 24 AF XY: 0.000143 AC XY: 10 AN XY: 69954

African (AFR) AF: 0.000102 AC: 4 AN: 39132

American (AMR) AF: 0.00 AC: 0 AN: 14642

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3200

East Asian (EAS) AF: 0.00 AC: 0 AN: 4928

South Asian (SAS) AF: 0.00 AC: 0 AN: 4630

European-Finnish (FIN) AF: 0.000200 AC: 2 AN: 9992

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000141 AC: 9 AN: 63764

Other (OTH) AF: 0.00 AC: 0 AN: 1978

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.29
Mutation Taster		=54/46	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs752404282; hg19: chr6-170871046;