6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-A
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_017633.3(TENT5A):c.87_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Gly30_Gly44del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000186 in 1,341,584 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_017633.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- osteogenesis imperfecta, type 18Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | NM_017633.3 | MANE Select | c.87_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly30_Gly44del | disruptive_inframe_deletion | Exon 2 of 3 | NP_060103.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | ENST00000320172.11 | TSL:1 MANE Select | c.87_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly30_Gly44del | disruptive_inframe_deletion | Exon 2 of 3 | ENSP00000318298.6 | ||
| TENT5A | ENST00000369756.3 | TSL:1 | c.330_374delCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly111_Gly125del | disruptive_inframe_deletion | Exon 2 of 3 | ENSP00000358771.3 | ||
| TENT5A | ENST00000369754.7 | TSL:1 | c.144_188delCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly49_Gly63del | disruptive_inframe_deletion | Exon 2 of 3 | ENSP00000358769.3 |
Frequencies
GnomAD3 genomes AF: 0.00000716 AC: 1AN: 139634Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000200 AC: 24AN: 1201950Hom.: 0 AF XY: 0.0000116 AC XY: 7AN XY: 603566 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000716 AC: 1AN: 139634Hom.: 0 Cov.: 0 AF XY: 0.0000148 AC XY: 1AN XY: 67626 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at