7-19117045-TGCCGCCGCCGCCGCCCGCGCCGCC-TGCCGCCGCCGCCGCCCGCGCCGCCGCCGCCGCCGCCCGCGCCGCCGCCGCCGCCGCCCGCGCCGCCGCCGCCGCCGCCCGCGCCGCC

Variant names:

• chr7-19117045-T-TGCCGCCGCCGCCGCCCGCGCCGCCGCCGCCGCCGCCCGCGCCGCCGCCGCCGCCGCCCGCGCC
• rs544465774
• NM_000474.4:c.276_277insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM1

The NM_000474.4(TWIST1):​c.276_277insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC​(p.Gly92_Ser93insGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000663 in 150,740 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
• Consequence: TWIST1 NM_000474.4 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.251
• Publications: 3 publications found

Genes affected

TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

TWIST1 Gene-Disease associations (from GenCC):

• Saethre-Chotzen syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, PanelApp Australia, Laboratory for Molecular Medicine, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
• TWIST1-related craniosynostosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
• isolated brachycephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated plagiocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated scaphocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Sweeney-Cox syndrome

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM1: In a chain Twist-related protein 1 (size 201) in uniprot entity TWST1_HUMAN there are 40 pathogenic changes around while only 6 benign (87%) in NM_000474.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000474.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TWIST1	NM_000474.4	MANE Select	c.276_277insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC	p.Gly92_Ser93insGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGly	conservative_inframe_insertion	Exon 1 of 2	NP_000465.1
	TWIST1	NR_149001.2		n.591_592insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC		non_coding_transcript_exon	Exon 1 of 3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TWIST1	ENST00000242261.6	TSL:1 MANE Select	c.276_277insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC	p.Gly92_Ser93insGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGlyGlyAlaGlyGlyGlyGlyGly	conservative_inframe_insertion	Exon 1 of 2	ENSP00000242261.5
	TWIST1	ENST00000354571.5	TSL:2	n.72_73insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC		non_coding_transcript_exon	Exon 1 of 3	ENSP00000346582.5
	TWIST1	ENST00000443687.5	TSL:4	n.-124_-123insGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGCGGCGCGGGCGGCGGCGGCGGC		upstream_gene	N/A	ENSP00000416986.1

Frequencies

GnomAD3 genomes AF: 0.00000663 AC: 1 AN: 150740 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000661

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 31

GnomAD4 genome AF: 0.00000663 AC: 1 AN: 150740 Hom.: 0 Cov.: 32 AF XY: 0.0000136 AC XY: 1 AN XY: 73528

African (AFR) AF: 0.00 AC: 0 AN: 41260

American (AMR) AF: 0.0000661 AC: 1 AN: 15130

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3446

East Asian (EAS) AF: 0.00 AC: 0 AN: 5116

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10212

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67464

Other (OTH) AF: 0.00 AC: 0 AN: 2068

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.25
Mutation Taster		=86/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs544465774; hg19: chr7-19156668;