7-76329649-CTGCATGATGAGCGTGGAGTCCTTG-C

Position:

• chr7-76329649-CTGCATGATGAGCGTGGAGTCCTTG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_012479.4(YWHAG):​c.648_671delCAAGGACTCCACGCTCATCATGCA​(p.Tyr216_Gln224delinsTer) variant causes a stop gained, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: YWHAG NM_012479.4 stop_gained, disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.96

Genes affected

YWHAG (HGNC:12852): (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma) This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the rat ortholog. It is induced by growth factors in human vascular smooth muscle cells, and is also highly expressed in skeletal and heart muscles, suggesting an important role for this protein in muscle tissue. It has been shown to interact with RAF1 and protein kinase C, proteins involved in various signal transduction pathways. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.129 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
YWHAG	NM_012479.4	c.648_671delCAAGGACTCCACGCTCATCATGCA	p.Tyr216_Gln224delinsTer	stop_gained, disruptive_inframe_deletion	2/2	ENST00000307630.5	NP_036611.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
YWHAG	ENST00000307630.5	c.648_671delCAAGGACTCCACGCTCATCATGCA	p.Tyr216_Gln224delinsTer	stop_gained, disruptive_inframe_deletion	2/2	1	NM_012479.4	ENSP00000306330.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 27, 2024

This sequence change creates a premature translational stop signal (p.Tyr216*) in the YWHAG gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 32 amino acid(s) of the YWHAG protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with developmental and epileptic encephalopathy (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-75958966;