8-85463769-AGGAGCCCCGGAGCCCCGGAGCCCC-AGGAGCCCCGGAGCCCCGGAGCCCCGGAGCCCCGGAGCCCCGGAGCCCC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000654303.1(CA3-AS1):n.9_32dupGGGGCTCCGGGGCTCCGGGGCTCC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000155 in 232,482 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000654303.1 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive osteopetrosis 3Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000654303.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CA3-AS1 | NR_121630.1 | n.334+789_334+812dupGGGGCTCCGGGGCTCCGGGGCTCC | intron | N/A | |||||
| CA3-AS1 | NR_121631.1 | n.106+435_106+458dupGGGGCTCCGGGGCTCCGGGGCTCC | intron | N/A | |||||
| CA2 | NM_000067.3 | MANE Select | c.-313_-312insGGAGCCCCGGAGCCCCGGAGCCCC | upstream_gene | N/A | NP_000058.1 | P00918 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CA3-AS1 | ENST00000654303.1 | n.9_32dupGGGGCTCCGGGGCTCCGGGGCTCC | non_coding_transcript_exon | Exon 1 of 3 | |||||
| CA3-AS1 | ENST00000517697.7 | TSL:4 | n.193+435_193+458dupGGGGCTCCGGGGCTCCGGGGCTCC | intron | N/A | ||||
| CA3-AS1 | ENST00000521761.6 | TSL:4 | n.334+789_334+812dupGGGGCTCCGGGGCTCCGGGGCTCC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.000218 AC: 32AN: 146586Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000350 AC: 3AN: 85810Hom.: 0 AF XY: 0.0000425 AC XY: 2AN XY: 47016 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000225 AC: 33AN: 146672Hom.: 0 Cov.: 0 AF XY: 0.000266 AC XY: 19AN XY: 71516 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at