9-127695053-TTGATGATGATGATGATGATGATGATGATGA-TTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA

Variant names:

• chr9-127695053-T-TTGATGATGATGATGATGATGATGA
• rs57076743
• ENST00000335223.5:c.270_293dupTCATCATCATCATCATCATCATCA

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP3

The ENST00000335223.5(PTRH1):​c.270_293dupTCATCATCATCATCATCATCATCA​(p.His90_His97dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000068 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000015 (0 hom.)
• Consequence: PTRH1 ENST00000335223.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.463

Genes affected

PTRH1 (HGNC:27039): (peptidyl-tRNA hydrolase 1 homolog) Enables RNA binding activity. [provided by Alliance of Genome Resources, Apr 2022]

STXBP1 (HGNC:11444): (syntaxin binding protein 1) This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000335223.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTRH1	XM_047422774.1	c.527_550dupTCATCATCATCATCATCATCATCA	p.Ile176_Ile183dup	conservative_inframe_insertion	Exon 5 of 5		XP_047278730.1
PTRH1	XM_047422775.1	c.371_394dupTCATCATCATCATCATCATCATCA	p.Ile124_Ile131dup	conservative_inframe_insertion	Exon 4 of 4		XP_047278731.1
STXBP1	NM_001374314.1	c.*55_*78dupATGATGATGATGATGATGATGATG		3_prime_UTR_variant	Exon 19 of 19		NP_001361243.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTRH1	ENST00000335223.5	c.270_293dupTCATCATCATCATCATCATCATCA	p.His90_His97dup	disruptive_inframe_insertion	Exon 2 of 3	1		ENSP00000493136.1
STXBP1	ENST00000636962.2	c.*55_*78dupATGATGATGATGATGATGATGATG		3_prime_UTR_variant	Exon 19 of 19	5		ENSP00000489762.1
STXBP1	ENST00000635950.2	n.*55_*78dupATGATGATGATGATGATGATGATG		non_coding_transcript_exon_variant	Exon 19 of 20	5		ENSP00000490903.1

Frequencies

GnomAD3 genomes AF: 0.00000678 AC: 1 AN: 147598 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000680

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000153 AC: 8 AN: 524098 Hom.: 0 Cov.: 0 AF XY: 0.0000106 AC XY: 3 AN XY: 283540

Gnomad4 AFR exome AF: 0.0000668

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000631

Gnomad4 SAS exome AF: 0.0000169

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000993

Gnomad4 OTH exome AF: 0.0000343

GnomAD4 genome AF: 0.00000678 AC: 1 AN: 147598 Hom.: 0 Cov.: 0 AF XY: 0.0000140 AC XY: 1 AN XY: 71656

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.0000680

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57076743; hg19: chr9-130457332;