9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr9-2039776-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs113070757
• NM_003070.5:c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_003070.5(SMARCA2):​c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln227_Gln236dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000133 in 150,432 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q236Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 26)
  • Exomes 𝑓: 0.0000069 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 9 publications found

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

SMARCA2 Gene-Disease associations (from GenCC):

• intellectual disability-sparse hair-brachydactyly syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Orphanet, G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• blepharophimosis-impaired intellectual development syndrome

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003070.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003070.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	NM_003070.5	MANE Select	c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	NP_003061.3
	SMARCA2	NM_001289396.2		c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	NP_001276325.1	P51531-1
	SMARCA2	NM_139045.4		c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 33	NP_620614.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	ENST00000349721.8	TSL:5 MANE Select	c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	ENSP00000265773.5	P51531-1
	SMARCA2	ENST00000382203.5	TSL:1	c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	ENSP00000371638.1	P51531-1
	SMARCA2	ENST00000450198.6	TSL:1	c.678_707dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln227_Gln236dup	disruptive_inframe_insertion	Exon 4 of 33	ENSP00000392081.2	F6VDE0

Frequencies

GnomAD3 genomes AF: 0.0000133 AC: 2 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.0000245

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000692 AC: 10 AN: 1445818 Hom.: 0 Cov.: 28 AF XY: 0.00000974 AC XY: 7 AN XY: 718570

African (AFR) AF: 0.0000305 AC: 1 AN: 32786

American (AMR) AF: 0.00 AC: 0 AN: 42718

Ashkenazi Jewish (ASJ) AF: 0.0000387 AC: 1 AN: 25866

East Asian (EAS) AF: 0.00 AC: 0 AN: 38448

South Asian (SAS) AF: 0.0000236 AC: 2 AN: 84908

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51680

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5568

European-Non Finnish (NFE) AF: 0.00000362 AC: 4 AN: 1104138

Other (OTH) AF: 0.0000335 AC: 2 AN: 59706

GnomAD4 genome AF: 0.0000133 AC: 2 AN: 150432 Hom.: 0 Cov.: 26 AF XY: 0.0000273 AC XY: 2 AN XY: 73378

African (AFR) AF: 0.0000245 AC: 1 AN: 40792

American (AMR) AF: 0.00 AC: 0 AN: 15108

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5096

South Asian (SAS) AF: 0.000212 AC: 1 AN: 4728

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67592

Other (OTH) AF: 0.00 AC: 0 AN: 2068

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0
Mutation Taster		=86/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113070757; hg19: chr9-2039776;