ENST00000414504.6:n.1110_1148delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-A
• rs193922930
• ENST00000414504.6:n.1110_1148delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000414504.6(ATXN8OS):​n.1110_1148delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: ATXN8OS ENST00000414504.6 splice_region, non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.190
• Publications: 0 publications found

Genes affected

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ATXN8OS Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 8

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ENSG00000288330 (HGNC:32925):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN8OS	NR_002717.3	n.902_940delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 5 of 5
ATXN8OS	NR_185834.1	n.454-7964_454-7926delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 3 of 4
ATXN8OS	NR_185835.1	n.454-7964_454-7926delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant	Intron 3 of 6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN8OS	ENST00000414504.6	n.1110_1148delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		splice_region_variant, non_coding_transcript_exon_variant	Exon 5 of 5	5
ENSG00000288330	ENST00000673087.1	n.10_48delCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	Exon 1 of 1
ATXN8OS	ENST00000756272.1	n.775_813delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 5 of 5

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.19

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;