ENST00000437147.8:n.1359-23800_1359-23781delAAAAAAAAAAAAAAAAAAAA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The ENST00000437147.8(TAF1):​n.712+12763_712+12782delCAATAATGGCTTCTAGTTTT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: not found (cov: 22)

Consequence

TAF1
ENST00000437147.8 intron

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 1.99
Variant links:
Genes affected
TAF1 (HGNC:11535): (TATA-box binding protein associated factor 1) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N- and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. Mutations in this gene result in Dystonia 3, torsion, X-linked, a dystonia-parkinsonism disorder. Alternative splicing of this gene results in multiple transcript variants. This gene is part of a complex transcription unit (TAF1/DYT3), wherein some transcript variants share exons with TAF1 as well as additional downstream DYT3 exons. [provided by RefSeq, Oct 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TAF1NM_004606.5 linkc.4753+12764_4753+12783delAATAATGGCTTCTAGTTTTC intron_variant Intron 32 of 37 ENST00000423759.6 NP_004597.3 P21675

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TAF1ENST00000423759.6 linkc.4753+12763_4753+12782delCAATAATGGCTTCTAGTTTT intron_variant Intron 32 of 37 5 NM_004606.5 ENSP00000406549.2 P21675

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-70656850; API