NM_000032.5:c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_ModeratePM2PP5

The NM_000032.5(ALAS2):​c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG​(p.Ser551ProfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 22)

Consequence

ALAS2
NM_000032.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.32
Variant links:
Genes affected
ALAS2 (HGNC:397): (5'-aminolevulinate synthase 2) The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
APEX2 (HGNC:17889): (apurinic/apyrimidinic endodeoxyribonuclease 2) Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0641 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is Pathogenic according to our data. Variant chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 60674.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ALAS2NM_000032.5 linkc.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG p.Ser551ProfsTer6 frameshift_variant Exon 11 of 11 ENST00000650242.1 NP_000023.2 P22557-1
APEX2NM_014481.4 linkc.*1833_*1858delCGACAGAAATTGCAGGCAGCCACAGA downstream_gene_variant ENST00000374987.4 NP_055296.2 Q9UBZ4E5KN95

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ALAS2ENST00000650242.1 linkc.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG p.Ser551ProfsTer6 frameshift_variant Exon 11 of 11 NM_000032.5 ENSP00000497236.1 P22557-1
APEX2ENST00000374987.4 linkc.*1833_*1858delCGACAGAAATTGCAGGCAGCCACAGA downstream_gene_variant 1 NM_014481.4 ENSP00000364126.3 Q9UBZ4

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

X-linked erythropoietic protoporphyria Pathogenic:1
Apr 01, 2013
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs879255567; hg19: chrX-55035700; API