NM_000033.4:c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000033.4(ABCD1):​c.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 25)

Consequence

ABCD1
NM_000033.4 frameshift, start_lost

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 2.78
Variant links:
Genes affected
ABCD1 (HGNC:61): (ATP binding cassette subfamily D member 1) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein is likely involved in the peroxisomal transport or catabolism of very long chain fatty acids. Defects in this gene have been identified as the underlying cause of adrenoleukodystrophy, an X-chromosome recessively inherited demyelinating disorder of the nervous system. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 71 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-153725248-GGCAGCCAGCCCAGGTGACATGCCGGT-G is Pathogenic according to our data. Variant chrX-153725248-GGCAGCCAGCCCAGGTGACATGCCGGT-G is described in ClinVar as [Pathogenic]. Clinvar id is 11317.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ABCD1NM_000033.4 linkc.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC p.Met1fs frameshift_variant, start_lost Exon 1 of 10 ENST00000218104.6 NP_000024.2 P33897
ABCD1NM_000033.4 linkc.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC 5_prime_UTR_variant Exon 1 of 10 ENST00000218104.6 NP_000024.2 P33897

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ABCD1ENST00000218104.6 linkc.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC p.Met1fs frameshift_variant, start_lost Exon 1 of 10 1 NM_000033.4 ENSP00000218104.3 P33897
ABCD1ENST00000218104 linkc.-16_10delAGCCAGCCCAGGTGACATGCCGGTGC 5_prime_UTR_variant Exon 1 of 10 1 NM_000033.4 ENSP00000218104.3 P33897

Frequencies

GnomAD3 genomes
Cov.:
25
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
25

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Adrenoleukodystrophy Pathogenic:2
Aug 14, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant is also known as _x0006_delta26, 369–394 deletion. Disruption of the initiator codon has been observed in individual(s) with X-linked adrenoleukodystrophy (PMID: 11739809, 18306728). It has also been observed to segregate with disease in related individuals. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects the initiator methionine of the ABCD1 mRNA. The next in-frame methionine is located at codon 67. -

Dec 11, 2001
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs387906497; hg19: chrX-152990703; API