NM_000038.6:c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000038.6(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT(p.Phe510MetfsTer17) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. F510F) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000038.6 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- classic or attenuated familial adenomatous polyposisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- desmoid tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- familial adenomatous polyposis 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- gastric adenocarcinoma and proximal polyposis of the stomachInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- APC-related attenuated familial adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Turcot syndrome with polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cenani-Lenz syndactyly syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000038.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | MANE Select | c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_000029.2 | |||
| APC | c.1614_1632+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe538MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | NP_001394375.1 | ||||
| APC | c.1584_1602+10delTGGAGATGTAGCCAACAAGGTATGTTTTT | p.Phe528MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | NP_001341825.1 | R4GMU6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | TSL:5 MANE Select | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 12 of 16 | ENSP00000257430.4 | P25054-1 | ||
| APC | TSL:1 | c.1527_1548+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | p.Phe510MetfsTer17 | frameshift splice_donor splice_region intron | Exon 13 of 17 | ENSP00000427089.2 | P25054-1 | ||
| APC | TSL:1 | n.*849_*870+7delTTTTGGAGATGTAGCCAACAAGGTATGTT | splice_region non_coding_transcript_exon | Exon 13 of 17 | ENSP00000424265.1 | E7EMH9 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at