NM_000044.6:c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3BP6_Very_StrongBS2
The NM_000044.6(AR):c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln71_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.
Frequency
Consequence
NM_000044.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -13 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln71_Gln80dup | disruptive_inframe_insertion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000750 AC: 50AN: 66636Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000343 AC: 321AN: 937045Hom.: 0 Cov.: 40 AF XY: 0.0000813 AC XY: 24AN XY: 295187 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000766 AC: 51AN: 66623Hom.: 0 Cov.: 0 AF XY: 0.000605 AC XY: 5AN XY: 8259 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:2
AR: BS2 -
This variant is associated with the following publications: (PMID: 2062380) -
Androgen resistance syndrome;C1839259:Kennedy disease Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at