NM_000059.4:c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000059.4(BRCA2):​c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT​(p.Ser2998IlefsTer19) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S2998S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA2
NM_000059.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.22

Publications

1 publications found
Variant links:
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]
BRCA2 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
  • Fanconi anemia complementation group D1
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
  • pancreatic cancer, susceptibility to, 2
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • sarcoma
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • medulloblastoma
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is Pathogenic according to our data. Variant chr13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 491367.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA2NM_000059.4 linkc.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2998IlefsTer19 frameshift_variant Exon 23 of 27 ENST00000380152.8 NP_000050.3 P51587

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA2ENST00000380152.8 linkc.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2998IlefsTer19 frameshift_variant Exon 23 of 27 5 NM_000059.4 ENSP00000369497.3 P51587
BRCA2ENST00000530893.7 linkc.8623_8656delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT p.Ser2875IlefsTer19 frameshift_variant Exon 23 of 27 1 ENSP00000499438.2 A0A590UJI7
BRCA2ENST00000614259.2 linkn.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT non_coding_transcript_exon_variant Exon 22 of 26 2 ENSP00000506251.1 A0A7P0TAP7
BRCA2ENST00000614259.2 linkn.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT 3_prime_UTR_variant Exon 22 of 26 2 ENSP00000506251.1 A0A7P0TAP7

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Feb 10, 2022
Color Diagnostics, LLC DBA Color Health
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant deletes 34 nucleotides in exon 23 of the BRCA2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in individuals affected with early onset and triple-negative breast cancer (PMID: 27616075, Color internal data). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.2
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555288450; hg19: chr13-32953923; API