NM_000059.4:c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000059.4(BRCA2):c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT(p.Ser2998IlefsTer19) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S2998S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000059.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
 - Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
 - pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
 - sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
 - hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
 - Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
 - medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
 
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt | 
|---|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | ENST00000380152.8  | c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2998IlefsTer19 | frameshift_variant | Exon 23 of 27 | 5 | NM_000059.4 | ENSP00000369497.3 | ||
| BRCA2 | ENST00000530893.7  | c.8623_8656delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2875IlefsTer19 | frameshift_variant | Exon 23 of 27 | 1 | ENSP00000499438.2 | |||
| BRCA2 | ENST00000614259.2  | n.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | non_coding_transcript_exon_variant | Exon 22 of 26 | 2 | ENSP00000506251.1 | ||||
| BRCA2 | ENST00000614259.2  | n.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | 3_prime_UTR_variant | Exon 22 of 26 | 2 | ENSP00000506251.1 | 
Frequencies
GnomAD3 genomes  Cov.: 32 
GnomAD4 genome  Cov.: 32 
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome    Pathogenic:1 
This variant deletes 34 nucleotides in exon 23 of the BRCA2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in individuals affected with early onset and triple-negative breast cancer (PMID: 27616075, Color internal data). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -
Computational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at