NM_000097.7:c.489_509delGTGCCAGGCTCTGGCACAGGT
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP5
The NM_000097.7(CPOX):c.489_509delGTGCCAGGCTCTGGCACAGGT(p.Cys164_Val170del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000097.7 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- CPOX-related hereditary coproporphyriaInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- harderoporphyriaInheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp
- hereditary coproporphyriaInheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000097.7. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CPOX | MANE Select | c.489_509delGTGCCAGGCTCTGGCACAGGT | p.Cys164_Val170del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000497326.1 | P36551-1 | ||
| CPOX | c.489_509delGTGCCAGGCTCTGGCACAGGT | p.Cys164_Val170del | disruptive_inframe_deletion | Exon 1 of 8 | ENSP00000616235.1 | ||||
| CPOX | c.489_509delGTGCCAGGCTCTGGCACAGGT | p.Cys164_Val170del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000602329.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at