NM_000127.3:c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000127.3(EXT1):​c.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT​(p.Val545fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

EXT1
NM_000127.3 frameshift, splice_acceptor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.04
Variant links:
Genes affected
EXT1 (HGNC:3512): (exostosin glycosyltransferase 1) This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is Pathogenic according to our data. Variant chr8-117812923-GATGATGTTGTCGTAGGGCAGAAAACGGCTGCTCATAACCTGGGAGGAAGTAGAAGTAGGCAGTGGGGAGGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 456063.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EXT1NM_000127.3 linkc.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT p.Val545fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 8 of 11 ENST00000378204.7 NP_000118.2 Q16394

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EXT1ENST00000378204.7 linkc.1633-34_1670delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT p.Val545fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 8 of 11 1 NM_000127.3 ENSP00000367446.3 Q16394
EXT1ENST00000437196.1 linkn.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT splice_region_variant, non_coding_transcript_exon_variant Exon 7 of 10 5 ENSP00000407299.1 F8WF54
EXT1ENST00000437196.1 linkn.*524-34_*561delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant Exon 7 of 10 5 ENSP00000407299.1 F8WF54
EXT1ENST00000684189.1 linkn.1100-34_1137delTCCCTCCCCACTGCCTACTTCTACTTCCTCCCAGGTTATGAGCAGCCGTTTTCTGCCCTACGACAACATCAT splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant Exon 8 of 11

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Multiple congenital exostosis Pathogenic:1
Aug 10, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is a gross deletion of the genomic region encompassing part of exon 8 of the EXT1 gene, including the intron 7-exon 8 boundary (c.1633-34_1670del). This likely creates a premature translational stop signal and is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). Loss-of-function variants in EXT1 are known to be pathogenic (PMID: 10679937, 11391482, 19810120). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554657940; hg19: chr8-118825162; API