NM_000138.5:c.8156_8175delAGATCAATGGCTACCCCAAA
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_000138.5(FBN1):c.8156_8175delAGATCAATGGCTACCCCAAA(p.Lys2719ThrfsTer12) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. K2719K) has been classified as Likely benign.
Frequency
Consequence
NM_000138.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- Marfan syndromeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
- Acromicric dysplasiaInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- progeroid and marfanoid aspect-lipodystrophy syndromeInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
- stiff skin syndromeInheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Weill-Marchesani syndrome 2, dominantInheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- isolated ectopia lentisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- neonatal Marfan syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Weill-Marchesani syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- ectopia lentis 1, isolated, autosomal dominantInheritance: AD Classification: LIMITED Submitted by: G2P
- Shprintzen-Goldberg syndromeInheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| FBN1 | NM_000138.5 | c.8156_8175delAGATCAATGGCTACCCCAAA | p.Lys2719ThrfsTer12 | frameshift_variant | Exon 65 of 66 | ENST00000316623.10 | NP_000129.3 | |
| FBN1 | NM_001406716.1 | c.8156_8175delAGATCAATGGCTACCCCAAA | p.Lys2719ThrfsTer12 | frameshift_variant | Exon 64 of 65 | NP_001393645.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Progeroid and marfanoid aspect-lipodystrophy syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at